![]() | Only 14 pages are availabe for public view |
Abstract Part I Phytochemical and biological investigations of Aspergillus sp. Chapter I Taxonomy of the fungus Aspergillus sp. 18B-15-3 The fungus 18B15-3 belongs to the following taxonomic group: Kingdom: Fungi . Division: Ascomycota. Class: Eurotiomycetes. Order: Eurotiales. Family: Trichocomaceae. Genus: Aspergillus. Species: sp. Chapter II Review of literature The literature survey showed that marine-derived fungi Aspergillus contains novel bioactive secondary metabolites which revealed promising biological potential such as antimicrobial, antitumor, antioxidant, anti-inflammatory, and enzymatic activities. Chapter III Identification of the fungus Aspergillus sp. 18B-15-3 Sequence of ITS region in marine-derived fungus Aspergillus ap. (18B15-3): TTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGCCCTCTGGGTCCAACCTCCCATCCGTGTCTATCTGTACCCTGTTGCTTCGGCGTGGCCACGGCCCGCCGGAGACTAACATTTGAACGCTGTCTGAAGTTTGCAGTCTGAGTTTTTAGTTAAACAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAATTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCTTCCGTCCCTGGCAACGGGGACGGGCCCAAAAGGCAGTGGCGGCACCATGTCTGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCCCGTAGGTCCAGCTGGCAGCTAGCCTCGCAACCAATCTTTTTAACCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAA Chapter IV Bio-guided fractionation and isolation of active compounds from the fungus Aspergillus sp. The crude extract was partitioned into a water–EtOAc mixture (1:1). For the bioassay, the active EtOAc fraction (IC50 = 25-µg/mL glucose-deprived medium and IC50 > 100-µg/mL general culture medium) was then partitioned into a n-hexane–90% aqueous MeOH mixture (1:1). The n-hexane fraction (IC50 =15.0-µg/mL glucose-deficient medium and IC50 > 100-µg/mL general culture medium) was then fractionated to afford eight fractions (Fr. 1–Fr. 8). Among these fractions, the active Fr. 6 was then separated by normal-phase HPLC to afford three fractions (Fr. 6-1–Fr. 6-3). The active fraction 6-2 was further purified by preparative TLC to obtain compound 1 and compound 2. On the guidance of antimycobacterial assay, the active EtOAc soluble fraction [5.2 g, MIC= 30 μg/mL against M. smegmatis under aerobic conditions] was further partitioned into an n-hexane-90% aqueous MeOH mixture. The n-hexane soluble fraction [MIC= 15 μg/mL against M. smegmatis under aerobic conditions] was then separated by column chromatography to obtained 8 fractions (Fr. 1-Fr. 8). Among these, Fr. 6 [MIC= 10 μg/mL against M. smegmatis under aerobic conditions] was separated by normal-phase HPLC to give compound 3 (3.9 mg). The active Fr. 5 [MIC= 10 μg/mL against M. smegmatis under aerobic conditions] precipitated compound 4 (4 mg). The active F-8 [MIC= 15 μg/mL against M. smegmatis under aerobic conditions] was separated by normal-phase HPLC to give compound 5. Chapter V Structural elucidation of the isolated compounds from the fungus Aspergillus sp. Structural elucidation of the isolated compounds was performed on the basis of various spectroscopic methods including: 1H-NMR, 13C-NMR, 1H -1H COSY, HSQC, HMBC and ESI-MS analyses. Chapter VI Biological activities of the isolated compounds the fungus Aspergillus sp. Compounds 1 and 2 were found to dose-dependently decrease mitochondrial membrane potential in PANC-1 cells, indicating that they inhibited mitochondrial function, which might be responsible for the selective cytotoxic effect of 1 and 2 on PANC-1 cells under glucose-deficient conditions. In addition, compounds 3-5 were evaluated for their antimicrobial activity against the dormant state of M. bovis BCG induced under hypoxic conditions. Unfortunately, compounds 4 and 5 were not effective against the dormant state of M. bovis BCG, and compound 4 showed very weak activity with an MIC value of 90 µM Part II Phytochemical and biological investigations of Melissa officinalis L. Chapter I Taxonomy of Melissa officinalis L. Melissa officinalis L. according to the latest classification belongs to: Kingdom: Plantae (Plants). Subkingdom: Tracheobionta (Vascular plants). Superdivision: Spermatophyta ( Seed plants). Division: Magnoliophyta (Flowering plants). Class: Magnoliopsida ( Dicotyledons). Subclass: Asteridae. Order: Lamiales. Family: Lamiaceae (Mint family). Genus: Melissa. (balm). Species: Melissa officinalis L. (Lemon balm). Subspecies: officinalis ( Lemon balm). Chapter II A Biological Review of Literature on the genus Melissa The genus Melissa exhibited a variety of biological actions such as cardioprotective, cytotoxic, anti-inflammatory, anti-nociceptive activities, antibacterial activity, antiviral activity, antifungal activity, hypoglycemic effect, hypolipidemic effect, antispasmodic activity, antiepileptic activity, antioxidant activity, anti-anxiety activity, and anti-angiogenic effect. Chapter III Biological studies on Melissa officinalis extract and different fractions 1-Anti-dormant mycobacterial activity of the total extract and different fractions of M. officinalis: The n-hexane fraction has a potent MIC value against M. bovis BCG when it is actively growing than when it is dormant. In contrast, the ethyl acetate and 90% MeOH fractions showed moderate anti-microbial activity against both M. smegmatis and M. bovis BCG. 2- Cytotoxic effects of the total extract and different fractions of M. officinalis on PANC-1 cells under glucose-deficient and general culture conditions: Ethyl acetate fraction exhibited higher cytotoxic activity against PANC-1 cells under general culture conditions (IC50 =25 µg/mL), whereas the cells cultured under starved conditions were not affected by it (IC50 > 100 µg/mL) |